Sab Sh3Bp5 Antibody Proteintech

Lab Reagents

Human IgG antibody Laboratories manufactures the sab sh3bp5 antibody proteintech reagents distributed by Genprice. The Sab Sh3Bp5 Antibody Proteintech reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact . Other Sab products are available in stock. Specificity: Sab Category: Sh3Bp5 Group: Antibody Proteintech

Antibody Proteintech information


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA25346 50 ul
EUR 334
Description: Mouse polyclonal to SH3BP5

SH3BP5 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SH3BP5. Recognizes SH3BP5 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

SH3BP5 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SH3BP5. Recognizes SH3BP5 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

SH3BP5 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SH3BP5. Recognizes SH3BP5 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

SH3BP5 Blocking Peptide

33R-8446 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SH3BP5 antibody, catalog no. 70R-10050

SH3BP5 Blocking Peptide

33R-5888 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SH3BP5 antibody, catalog no. 70R-10051

SH3BP5 Blocking Peptide

DF12738-BP 1mg
EUR 195

SH3BP5 cloning plasmid

CSB-CL021226HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1278
  • Sequence: atggagcaggggctggaggaggaagaagaggtggatccccggatccagggagaactggagaagttaaatcagtccacggatgatatcaacagacgggagactgaacttgaggatgctcgtcagaagttccgctctgttctggttgaagcaacggtgaaactggatgaactggtga
  • Show more
Description: A cloning plasmid for the SH3BP5 gene.

anti-SH3BP5 (2B3)

LF-MA10300 100 ug
EUR 363
Description: Mouse monoclonal to SH3BP5

Anti-SH3BP5 (1D5)

YF-MA16858 100 ug
EUR 363
Description: Mouse monoclonal to SH3BP5

Polyclonal SH3BP5 Antibody (N-Term)

APR09914G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SH3BP5 (N-Term). This antibody is tested and proven to work in the following applications:


EF002903 96 Tests
EUR 689

Mouse SH3BP5 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat SH3BP5 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human SH3BP5 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.