Rabbit Ployclonal Antibody Sds

Lab Reagents

Human IgG antibody Laboratories manufactures the rabbit ployclonal antibody sds reagents distributed by Genprice. The Rabbit Ployclonal Antibody Sds reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact rabbit Antibody. Other Rabbit products are available in stock. Specificity: Rabbit Category: Ployclonal Group: Antibody Sds

Antibody Sds information

SDS Polyclonal Antibody

27842-50ul 50ul
EUR 187

Anti-SDS antibody

STJ114764 100 µl
EUR 277
Description: This gene encodes one of three enzymes that are involved in metabolizing serine and glycine. L-serine dehydratase converts L-serine to pyruvate and ammonia and requires pyridoxal phosphate as a cofactor. The encoded protein can also metabolize threonine to NH4+ and 2-ketobutyrate. The encoded protein is found predominantly in the liver.

Sds/ Rat Sds ELISA Kit

ELI-15462r 96 Tests
EUR 886

SDS Solution

EUR 137


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

10% SDS

TG4060 1ml
EUR 134


YF-PA17352 50 ug
EUR 363
Description: Mouse polyclonal to SDS

SDS Polyclonal Conjugated Antibody

C27842 100ul
EUR 397

dAbs scaffold protein anti-Human B5R

SDS-L073 1 mg
EUR 4496
Description: Scaffold protein

TG-SDS Buffer (Tris-Glycine-SDS) 10X Solution

A0030 4L
EUR 94.8
  • Product category: Biochemicals/Biological Buffers/Common Buffers

TT-SDS (Tris-Tricine-SDS buffer) Premix powder

TD8135 1PK, 10L
EUR 76.1
  • Product category: Biochemicals/Biological Buffers/Common Buffers

TG-SDS, 10X (Tris-Glycine SDS), pH 8.4

UA0030 500ml
EUR 67.4
  • Product category: Biochemicals/Biological Buffers/Common Buffers

SDS Blocking Peptide

33R-4446 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SDS antibody, catalog no. 70R-3762

SDS Blocking Peptide

33R-1011 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of DISC1 antibody, catalog no. 70R-2399

SDS cloning plasmid

CSB-CL020926HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 657
  • Sequence: atgatgtctggagaacccctgcacgtgaagacccccatccgtgacagcatggccctgtccaaaatggccggcaccagcgtctacctcaagatggacagtgcccagccctccggctccttcaagatccggggcattgggcacttctgcaagaggtgggccaagcaaggctgtgcaca
  • Show more
Description: A cloning plasmid for the SDS gene.