Rabbit Polyclonal Antibody Of Human Pcp4

Lab Reagents

Human Polyclonal Laboratories manufactures the rabbit polyclonal antibody of human pcp4 reagents distributed by Genprice. The Rabbit Polyclonal Antibody Of Human Pcp4 reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact human polyclonal. Other Rabbit products are available in stock. Specificity: Rabbit Category: Polyclonal Group: Antibody Of

Antibody Of information

Anti-PCP4 Antibody

EUR 479

Anti-PCP4 antibody

PAab06222 100 ug
EUR 355


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PCP4 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PCP4. Recognizes PCP4 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

PCP4 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PCP4. Recognizes PCP4 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

PCP4 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PCP4. Recognizes PCP4 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA


EF001614 96 Tests
EUR 689

Human PCP4 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

PCP4 Recombinant Protein (Human)

RP022792 100 ug Ask for price

PCP4 cloning plasmid

CSB-CL017636HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 189
  • Sequence: atgagtgagcgacaaggtgctggggcaaccaatggaaaagacaagacatctggtgaaaatgatggacagaagaaagttcaagaagaatttgacattgacatggatgcaccagagacagaacgtgcagcggtggccattcagtctcagttcagaaaattccagaagaagaaggctgg
  • Show more
Description: A cloning plasmid for the PCP4 gene.


PVT13824 2 ug
EUR 391

Anti-PCP4 (1E3)

YF-MA10673 100 ug
EUR 363
Description: Mouse monoclonal to PCP4

PCP4 ORF Vector (Human) (pORF)

ORF007598 1.0 ug DNA
EUR 95

Rat PCP4 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse PCP4 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.