Human Klf6 Antibody R&D Systems

Lab Reagents

Human Antibody Laboratories manufactures the human klf6 antibody r&d systems reagents distributed by Genprice. The Human Klf6 Antibody R&D Systems reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact human Antibody. Other Human products are available in stock. Specificity: Human Category: Klf6 Group: Antibody R&D

Antibody R&D information


PVTH0011 2 ug
EUR 345


YF-PA23492 50 ul
EUR 334
Description: Mouse polyclonal to KLF6

Anti-KLF6 SV1 Antibody

STJ501555 100 µg
EUR 476


EF010552 96 Tests
EUR 689

Human KLF6 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

KLF6 Recombinant Protein (Human)

RP017095 100 ug Ask for price

KLF6 Recombinant Protein (Human)

RP017098 100 ug Ask for price

KLF6 Rabbit pAb

A10011-100ul 100 ul
EUR 308

KLF6 Rabbit pAb

A10011-200ul 200 ul
EUR 459

KLF6 Rabbit pAb

A10011-20ul 20 ul
EUR 183

KLF6 Rabbit pAb

A10011-50ul 50 ul
EUR 223

KLF6 cloning plasmid

CSB-CL859936HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 852
  • Sequence: atggacgtgctccccatgtgcagcatcttccaggagctccagatcgtgcacgagaccggctacttctcggcgctgccgtctctggaggagtactggcaacagacctgcctagagctggaacgttacctccagagcgagccctgctatgtttcagcctcagaaatcaaatttgacag
  • Show more
Description: A cloning plasmid for the KLF6 gene.

KLF6 cloning plasmid

CSB-CL859936HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 783
  • Sequence: atggacgtgctccccatgtgcagcatcttccaggagctccagatcgtgcacgagaccggctacttctcggcgctgccgtctctggaggagtactggcaacagacctgcctagagctggaacgttacctccagagcgagccctgctatgtttcagcctcagaaatcaaatttgacag
  • Show more
Description: A cloning plasmid for the KLF6 gene.

KLF6 Blocking Peptide

DF13114-BP 1mg
EUR 195

anti-KLF6 (1A9)

LF-MA10159 100 ug
EUR 363
Description: Mouse monoclonal to KLF6

Anti-KLF6 (3C4)

YF-MA12504 100 ug
EUR 363
Description: Mouse monoclonal to KLF6

Polyclonal KLF6 Antibody (N-term)

AMM08636G 0.1ml
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human KLF6 (N-term). This antibody is tested and proven to work in the following applications: